The Daily Transcript

Daily news and views from a postdoctoral fellow in Cell Biology.
UCACACCUGGUGGAAGCUCUCUACCUAGUGUGCGGGGAACGAGGCUUCUUCUACACACCCAAGACCCGCCGGGAGGCAGAGGACCUGCAGGUGGGGCAGGUGGAGCUGGGCGGGGGCCCUGGUGCAGGCAGCCUGCAGCC

Wednesday, November 02, 2005

Eye Candy

A mouse fibroblast, imaged using DIC (Differential Interferance Contrast) microscopy.

posted by apalazzo at 9:22 AM

|

About Me

: Name: apalazzo; Location: Toronto, Ontario, Canada

View my complete profile

Archives

August 2005
September 2005
October 2005
November 2005
December 2005
January 2006
February 2006
March 2006
August 2006
My old blog at Tripod

RNA Blogs

Rambling Thoughts of the Prof Bil The Man
Bartholomew Cubbins on RNA

Science Blogs

Postgenomic
ScienceBlogs
Pharyngula
Science & Politics
Genetics and Health Blog
The Panda's Thumb

One Degree of Separation Blogs

String of Ideas
Tulula's Blog
The happy News
Ben's Blog
Tales of a Tall Medstudent
aroundabout me

Club Blogs

Boston Bookclub
SocArt

javascript hit counter

Locations of visitors to this page

The Daily Transcript Q&As